|
|
descseq |
descseq reads a sequence and writes it to file but with a different name and / or description. All other records including the sequence itself are left unaltered.
Set the name of a sequence to "myclone23"
% descseq -seq dna.text -out clone23.seq -name "myclone23" Alter the name or description of a sequence. |
Go to the input files for this example
Go to the output files for this example
Example 2
Set the description of a sequence to "This is my clone number 244"
% descseq -seq dna.text -out xy24.seq -desc "This is my clone number 244" Alter the name or description of a sequence. |
Go to the output files for this example
Example 3
Append some text to the description of a sequence
% descseq -seq dna.text -out est4.seq -desc " (submitted)" -append Alter the name or description of a sequence. |
Go to the output files for this example
Standard (Mandatory) qualifiers:
[-sequence] sequence (Gapped) sequence filename and optional
format, or reference (input USA)
[-outseq] seqout [
|
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-sequence] (Parameter 1) |
(Gapped) sequence filename and optional format, or reference (input USA) | Readable sequence | Required |
| [-outseq] (Parameter 2) |
Sequence filename and optional format (output USA) | Writeable sequence | <*>.format |
| Additional (Optional) qualifiers | Allowed values | Default | |
| -name | Name of the sequence | Any string is accepted | An empty string is accepted |
| -description | Description of the sequence | Any string is accepted | An empty string is accepted |
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| -append | This allows you to append the name or description you have given on to the end of the existing name or description of the sequence. | Boolean value Yes/No | No |
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC GTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT |
>myclone23 ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT |
>EMBOSS_001 This is my clone number 244 ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT |
>EMBOSS_001 (submitted) ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT |
Most sequence formats allow, at the very minimum, a name for the sequence and some comments to be stored in the sequence file. descseq let's you change the sequence name and / or description, and is far more convenient and less error-prone than using the editor for editing.
The default action is to replace the existing name or description with your new one, but by using the qualifier -append what you enter is appended to the existing name or description. Note that if you append to a description, no space is inserted by default bewteen the existing description and your appended text. You have to put in a space yourself if you require one.
| Program name | Description |
|---|---|
| aligncopy | Reads and writes alignments |
| aligncopypair | Reads and writes pairs from alignments |
| biosed | Replace or delete sequence sections |
| codcopy | Copy and reformat a codon usage table |
| cutseq | Removes a section from a sequence |
| degapseq | Removes non-alphabetic (e.g. gap) characters from sequences |
| entret | Retrieves sequence entries from flatfile databases and files |
| extractalign | Extract regions from a sequence alignment |
| extractfeat | Extract features from sequence(s) |
| extractseq | Extract regions from a sequence |
| featcopy | Reads and writes a feature table |
| featreport | Reads and writes a feature table |
| listor | Write a list file of the logical OR of two sets of sequences |
| makenucseq | Create random nucleotide sequences |
| makeprotseq | Create random protein sequences |
| maskambignuc | Masks all ambiguity characters in nucleotide sequences with N |
| maskambigprot | Masks all ambiguity characters in protein sequences with X |
| maskfeat | Write a sequence with masked features |
| maskseq | Write a sequence with masked regions |
| newseq | Create a sequence file from a typed-in sequence |
| nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
| noreturn | Remove carriage return from ASCII files |
| nospace | Remove all whitespace from an ASCII text file |
| notab | Replace tabs with spaces in an ASCII text file |
| notseq | Write to file a subset of an input stream of sequences |
| nthseq | Write to file a single sequence from an input stream of sequences |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a nucleotide sequence |
| seqret | Reads and writes (returns) sequences |
| seqretsplit | Reads sequences and writes them to individual files |
| sizeseq | Sort sequences by size |
| skipredundant | Remove redundant sequences from an input set |
| skipseq | Reads and writes (returns) sequences, skipping first few |
| splitter | Split sequence(s) into smaller sequences |
| trimest | Remove poly-A tails from nucleotide sequences |
| trimseq | Remove unwanted characters from start and end of sequence(s) |
| trimspace | Remove extra whitespace from an ASCII text file |
| union | Concatenate multiple sequences into a single sequence |
| vectorstrip | Removes vectors from the ends of nucleotide sequence(s) |
| yank | Add a sequence reference (a full USA) to a list file |